Top » Catalog » SNPs » FGC21113

$18.00

FGC21113
[FGC21113]

FGC21113
hg38 Position: ChrY:21204900..21204900
Ancestral: A
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC21113_F CCTGGTGAATCCAACAATAAGG
Reverse Primer: FGC21113_R ATCTGCGTTGAAAAGGGATG
Reviews

Customers who bought this product also purchased
A19100
A19100
A19315
A19315
A19113
A19113
FGC21103
FGC21103
A19080
A19080
A19152
A19152
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies