Top » Catalog » SNPs » FGC21220

$18.00

FGC21220
[FGC21220]

FGC21220
hg38 Position: ChrY:8786802..8786802
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC21220vl_F AGGGAATTGATGTCGGTGTG
Reverse Primer: FGC21220vl_R TCTCACTCTGTTGTCCATCCC
Reviews

Customers who bought this product also purchased
FGC21219
FGC21219
R1a-YP6375 Bures Panel
R1a-YP6375 Bures Panel
FGC21229
FGC21229
A19117
A19117
FGC21241
FGC21241
FGC21217
FGC21217
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies