Top » Catalog » SNPs » FGC21226

$18.00

FGC21226
[FGC21226]

FGC21226
hg38 Position: ChrY:13585218..13585218
Ancestral: A
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC21226v2_F AACTTCACCATCACACAATATACCAC
Reverse Primer: FGC21226v2_R GTATGATAGAATGTGGCCCAGG
Reviews

Customers who bought this product also purchased
FGC21216
FGC21216
FGC21224
FGC21224
A19097
A19097
FGC21239
FGC21239
A19311
A19311
FGC21223
FGC21223
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies