Top » Catalog » SNPs » FGC21226

$18.00

FGC21226
[FGC21226]

FGC21226
hg38 Position: ChrY:13585218..13585218
Ancestral: A
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC21226v2_F AACTTCACCATCACACAATATACCAC
Reverse Primer: FGC21226v2_R GTATGATAGAATGTGGCCCAGG
Reviews

Customers who bought this product also purchased
FGC21220
FGC21220
A19083
A19083
FGC21234
FGC21234
A19123
A19123
FGC21244
FGC21244
FGC21219
FGC21219
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies