Top » Catalog » SNPs » FGC21226

$18.00

FGC21226
[FGC21226]

FGC21226
hg38 Position: ChrY:13585218..13585218
Ancestral: A
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC21226v2_F AACTTCACCATCACACAATATACCAC
Reverse Primer: FGC21226v2_R GTATGATAGAATGTGGCCCAGG
Reviews

Customers who bought this product also purchased
A19123
A19123
FGC21244
FGC21244
FGC21219
FGC21219
R1a-YP6375 Bures Panel
R1a-YP6375 Bures Panel
FGC21229
FGC21229
A19117
A19117
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies