Top » Catalog » SNPs » FGC21227

$18.00

FGC21227
[FGC21227]

FGC21227
hg38 Position: ChrY:14979904..14979904
Ancestral: G
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC21227v2_F AATGCCAGAGCTCTACCTGC
Reverse Primer: FGC21227v2_R GAATTACAAGATGGCCCACC
Reviews

Customers who bought this product also purchased
A19083
A19083
FGC21234
FGC21234
A19123
A19123
FGC21244
FGC21244
FGC21219
FGC21219
R1a-YP6375 Bures Panel
R1a-YP6375 Bures Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies