Top » Catalog » SNPs » Z17807

$18.00

Z17807
[Z17807]

Z17807
hg38 Position: ChrY:15911455..15911455
Ancestral: T
Derived: C
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of L513>S6365
Forward Primer: Z17807_F CGTTTAGCTGGTTGAATGAATG
Reverse Primer: Z17807_R GGGCATGGTAGTGGACATC
Reviews

Customers who bought this product also purchased
Z16385
Z16385
Z39589
Z39589
CTS6621
CTS6621
DF13
DF13
Z16361
Z16361
FGC11791
FGC11791
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies