Top » Catalog » SNPs » Z17807

$18.00

Z17807
[Z17807]

Z17807
hg38 Position: ChrY:15911455..15911455
Ancestral: T
Derived: C
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of L513>S6365
Forward Primer: Z17807_F CGTTTAGCTGGTTGAATGAATG
Reverse Primer: Z17807_R GGGCATGGTAGTGGACATC
Reviews

Customers who bought this product also purchased
FGC11791
FGC11791
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
R1b-L513 Panel
R1b-L513 Panel
BY359
BY359
S6365
S6365
L1333
L1333
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies