Top » Catalog » SNPs » FGC21235

$18.00

FGC21235
[FGC21235]

FGC21235
hg38 Position: ChrY:19358948..19358948
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC21235_F AGCAAAACCTGGTAGAGATGC
Reverse Primer: FGC21235_R TGTATGGTCCAAGCTGGTCTC
Reviews

Customers who bought this product also purchased
A19123
A19123
FGC21244
FGC21244
FGC21219
FGC21219
R1a-YP6375 Bures Panel
R1a-YP6375 Bures Panel
FGC21227
FGC21227
A19117
A19117
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies