Top » Catalog » SNPs » FGC21235

$18.00

FGC21235
[FGC21235]

FGC21235
hg38 Position: ChrY:19358948..19358948
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC21235_F AGCAAAACCTGGTAGAGATGC
Reverse Primer: FGC21235_R TGTATGGTCCAAGCTGGTCTC
Reviews

Customers who bought this product also purchased
A19123
A19123
FGC21244
FGC21244
FGC21219
FGC21219
R1a-YP6375 Bures Panel
R1a-YP6375 Bures Panel
FGC21227
FGC21227
A19117
A19117
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY32665
1 x L1364
1 x P77
1 x A1379
1 x BY31191
1 x A6249
1 x BY122504
1 x A5494
1 x A1994
1 x A18898
1 x BY181693
1 x A6231
1 x A1353
1 x A1603
1 x A5991
1 x A1818
1 x A6003
1 x A25063
1 x A6044
1 x A407
1 x A1807
1 x BY45363
1 x A1350
1 x FT277325
1 x A5417
1 x CTS10538
1 x FGC1408
1 x A5573
1 x A5566
$522.00
Haplogroup Info
Other products
Currencies