Top » Catalog » SNPs » FGC21239

$18.00

FGC21239
[FGC21239]

FGC21239
hg38 Position: ChrY:20470741..20470741
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC21239_F TCCATGCTGCCCTTTCTTAG
Reverse Primer: FGC21239_R GTCATGGAAGCCAGAGGTTG
Reviews

Customers who bought this product also purchased
FGC21235
FGC21235
A19097
A19097
A19311
A19311
FGC21223
FGC21223
FGC21234
FGC21234
A19095
A19095
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies