Top » Catalog » SNPs » FGC21239

$18.00

FGC21239
[FGC21239]

FGC21239
hg38 Position: ChrY:20470741..20470741
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC21239_F TCCATGCTGCCCTTTCTTAG
Reverse Primer: FGC21239_R GTCATGGAAGCCAGAGGTTG
Reviews

Customers who bought this product also purchased
FGC21226
FGC21226
A19103
A19103
FGC21240
FGC21240
FGC21216
FGC21216
FGC21224
FGC21224
FGC21235
FGC21235
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies