Top » Catalog » SNPs » FGC21244

$18.00

FGC21244
[FGC21244]

FGC21244
hg38 Position: ChrY:21100459..21100459
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC21244_F CAAGCATTTAGAATGAGCAAAAAG
Reverse Primer: FGC21244_R GCACAATCTCAGCTCACTGC
Reviews

Customers who bought this product also purchased
A19103
A19103
FGC21239
FGC21239
FGC21216
FGC21216
FGC21224
FGC21224
A19097
A19097
FGC21235
FGC21235
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies