Top » Catalog » SNPs » FGC37075

$18.00

FGC37075
[FGC37075]

FGC37075
hg38 Position: ChrY:16504096..16504096
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC37075_F CAAACAGCAGTGATCAGAAGC
Reverse Primer: FGC37075_R ACACCCTGTAGTCCCAGTGC
Reviews

Customers who bought this product also purchased
FGC37077
FGC37077
FGC37076
FGC37076
FGC37071
FGC37071
FGC37074
FGC37074
FGC37080
FGC37080
FGC37073
FGC37073
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies