Top » Catalog » SNPs » FGC37077

$18.00

FGC37077
[FGC37077]

FGC37077
hg38 Position: ChrY:18941821..18941821
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: R1a
Comments: Below Z280 > YP237 > YP951 > YP977 > YP1038
Forward Primer: FGC37077_F CTTGGCCTTCCAAAAATAGC
Reverse Primer: FGC37077_R CTGCTGAAAAGACCAGAAGC
Reviews

Customers who bought this product also purchased
FGC37073
FGC37073
FGC37079
FGC37079
FGC37072
FGC37072
FGC37078
FGC37078
FGC37076
FGC37076
FGC37075
FGC37075
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies