Top » Catalog » SNPs » FGC21217

$18.00

FGC21217
[FGC21217]

FGC21217
hg38 Position: ChrY:7851865..7851865
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC21217_F GAGCTCGATACAATTTCCCC
Reverse Primer: FGC21217_R TTCTACTTCTGTCATCTTAGGCCTC
Reviews

Customers who bought this product also purchased
A19117
A19117
FGC21241
FGC21241
FGC21219
FGC21219
FGC21227
FGC21227
A19103
A19103
FGC21240
FGC21240
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies