Top » Catalog » SNPs » FGC21216

$18.00

FGC21216
[FGC21216]

FGC21216
hg38 Position: ChrY:7835697..7835697
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC21216_F GGAAAATACTAATACTCTTTTGTTGGACA
Reverse Primer: FGC21216_R GAGGTAACTCAGTCCAAGTCAGC
Reviews

Customers who bought this product also purchased
R1a-YP6375 Bures Panel
R1a-YP6375 Bures Panel
FGC21229
FGC21229
A19117
A19117
FGC21241
FGC21241
FGC21219
FGC21219
FGC21227
FGC21227
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies