Top » Catalog » SNPs » A890

$18.00

A890
[A890]

A890
hg38 Position: ChrY:2914550..2914550
Ancestral: C
Derived: T
Reference: Maynard (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream or equivalent L701
Forward Primer: A890_F TGGTTCACCTCAAGGAACTAGG
Reverse Primer: A890_R TTGGAAGTATTCCCTCCTCTTC
Reviews

Customers who bought this product also purchased
FGC5494
FGC5494
A907
A907
L701
L701
A892
A892
A898
A898
A904
A904
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A506
1 x A1063
1 x A2205
1 x A5
1 x A1228
1 x A894
1 x A307
1 x A1717
1 x A93
1 x A1065
1 x A1105
1 x A1293
1 x A962
1 x A310
1 x A1509
1 x A720
$288.00
Haplogroup Info
Other products
Currencies