Top » Catalog » SNPs » A20139

$18.00

A20139
[A20139]

A20139
hg38 Position: ChrY:12921195..12921195
Ancestral: G
Derived: A
Reference: Bruce Cockburn (2018)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A20139_F TCGCATAAGCACGTTTTGTC
Reverse Primer: A20139_R GAAGGAGCATTGGCGTTTAC
Reviews

Customers who bought this product also purchased
A20143
A20143
A20142
A20142
A20141
A20141
Z36747
Z36747
A20140
A20140
Y16690
Y16690
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies