Top » Catalog » SNPs » A20299

$18.00

A20299
[A20299]

A20299
hg38 Position: ChrY:14876733..14876733
Ancestral: G
Derived: C
Reference: Walter Little (2018)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A20299_F TGGGGTTTAAGTGACCAAGG
Reverse Primer: A20299_R AAATTTCAATGGGGTTTTTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies