Top » Catalog » SNPs » A20300

$18.00

A20300
[A20300]

A20300
hg38 Position: ChrY:20610199..20610199
Ancestral: T
Derived: A
Reference: Walter Little (2018)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A20300_F CACCTGAAGGCCAATAATCC
Reverse Primer: A20300_R CCCTTAAGTAAATTTTGAACTGTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies