Top » Catalog » SNPs » A20306

$18.00

A20306
[A20306]

A20306
hg38 Position: ChrY:12609813..12609813
Ancestral: A
Derived: G
Reference: 2018
ISOGG Haplogroup: J1
Comments:
Forward Primer: A20306v2_F CACAGTGAGACCTCATCTCCAG
Reverse Primer: A20306v2_R TTCCTGGTTCAAGCAATTCTG
Reviews

Customers who bought this product also purchased
A20304
A20304
Y133692
Y133692
A20307
A20307
A20305
A20305
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies