Top » Catalog » SNPs » FGC8388

$18.00

FGC8388
[FGC8388]

FGC8388
hg38 Position: ChrY:12558912..12558912
Ancestral: T
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: unknown
Comments: .
Forward Primer: FGC8388_F TTTGTATTTCAATGGTATGAGTTGC
Reverse Primer: FGC8388_R TTCTTCACACAGACTTGCATGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies