Top » Catalog » SNPs » Y98077

$18.00

Y98077
[Y98077]

Y98077
hg38 Position: ChrY:14943126..14943126
Ancestral: A
Derived: G
Reference: YFull (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y98077_F ATAAAAATAAAATATCCATTCTGAAGCTATG
Reverse Primer: Y98077_R ACTAGTGTTCTTTGTTTCCCAGGG
Reviews

Customers who bought this product also purchased
A20330
A20330
A20331
A20331
A20329
A20329
Y93531
Y93531
Y95032
Y95032
Y95033
Y95033
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies