Top » Catalog » SNPs » Y99421

$18.00

Y99421
[Y99421]

Y99421
hg38 Position: ChrY:15414114..15414114
Ancestral: T
Derived: C
Reference: YFull (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y99421_F TCCAGTGCTGCATGTTTACC
Reverse Primer: Y99421_R GTTTTGGCATCCAGTTTTGG
Reviews

Customers who bought this product also purchased
Y95033
Y95033
Y98077
Y98077
Y84935
Y84935
A20330
A20330
A20331
A20331
A20329
A20329
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies