Top » Catalog » SNPs » FGC67727

$18.00

FGC67727
[FGC67727]

FGC67727
hg38 Position: ChrY:8517641..8517641
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC67727_F ATGGGCAGCTCAAGGATATG
Reverse Primer: FGC67727_R TATCCAGATGGGGAATGGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies