Top » Catalog » SNPs » FGC67728

$18.00

FGC67728
[FGC67728]

FGC67728
hg38 Position: ChrY:20018758..20018758
Ancestral: T
Derived: G
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC67728_F GCTGGCGTCTAAGGCTTG
Reverse Primer: FGC67728_R CAATGACAACATGACTGAAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies