Top » Catalog » SNPs » A20182

$18.00

A20182
[A20182]

A20182
hg38 Position: ChrY:13592498..13592498
Ancestral: A
Derived: G
Reference: Zdenko Markovic (2018)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: A20182_F AGCCACTCTTCAGAGCCATC
Reverse Primer: A20182_R ACACCAGCAAAATGCAAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies