Top » Catalog » SNPs » Y83966

$18.00

Y83966
[Y83966]

Y83966
hg38 Position: ChrY:7483179..7483179
Ancestral: T
Derived: G
Reference: YFull (2017)
ISOGG Haplogroup: R1b
Comments: Below A541/A11844
Forward Primer: Y83966_F TAACCTGCATGGTGGAACAC
Reverse Primer: Y83966_R ACCCCTCCAAATCTCCAATG
Reviews

Customers who bought this product also purchased
Y89370
Y89370
Y104298
Y104298
Y100599
Y100599
Y92986
Y92986
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies