Top » Catalog » SNPs » A20347

$18.00

A20347
[A20347]

A20347
hg38 Position: ChrY:8952083..8952083
Ancestral: G
Derived: C
Reference: Ed Aber Leek (2018)
ISOGG Haplogroup: R1b
Comments: Below A541/A11844
Forward Primer: A20347_F CCATTTTTCATTGGTCATTTG
Reverse Primer: A20347_R GAAAACCATGCAGGAGATAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies