Top » Catalog » SNPs » A20351

$18.00

A20351
[A20351]

A20351
hg38 Position: ChrY:7810540..7810540
Ancestral: C
Derived: T
Reference: Michael Cooley (2018)
ISOGG Haplogroup: R1b
Comments: Downstream A12020
Forward Primer: A20351_F GCAGGCAGGAATGTAATGTC
Reverse Primer: A20351_R TGGACCCAGCCACATATAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies