Top » Catalog » SNPs » DC205

$18.00

DC205
[DC205]

DC205
hg38 Position: ChrY:14153776..14153776
Ancestral: A
Derived: C
Reference: Dennis Wright (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below L226
Forward Primer: DC205_F GACAGTCCTAAACCCCAAAGC
Reverse Primer: DC205_R TTCCAGCTCCTTCACATTCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies