Top » Catalog » SNPs » DF5

$18.00

DF5
[DF5]

DF5
hg38 Position: ChrY:16281934..16281934
Ancestral: A
Derived: G
Reference: http://dna-forums.com/
ISOGG Haplogroup: R1b1a1a2a1a2c1g2a1a
Comments: Approx. hg. R-L21*
Forward Primer: DF5_F GCCACCCTCTTTGGGAGTTGT
Reverse Primer: DF5_R ACACTGAGTTTTCTCTGACATCTGT
Reviews

Customers who bought this product also purchased
A14079
A14079
S953
S953
Z16274
Z16274
FGC41929
FGC41929
Z39589
Z39589
FGC41930
FGC41930
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies