Top » Catalog » SNPs » DF5

$18.00

DF5
[DF5]

DF5
hg38 Position: ChrY:16281934..16281934
Ancestral: A
Derived: G
Reference: http://dna-forums.com/
ISOGG Haplogroup: R1b1a1a2a1a2c1g2a1a
Comments: Approx. hg. R-L21*
Forward Primer: DF5_F GCCACCCTCTTTGGGAGTTGT
Reverse Primer: DF5_R ACACTGAGTTTTCTCTGACATCTGT
Reviews

Customers who bought this product also purchased
Z2103
Z2103
U152
U152
FGC14590
FGC14590
Z29644
Z29644
M985
M985
FGC14589
FGC14589
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies