Top » Catalog » SNPs » A11837

$18.00

A11837
[A11837]

A11837
hg38 Position: ChrY:11987755..11987755
Ancestral: C
Derived: A
Reference: Tyson Smith (2016)
ISOGG Haplogroup: E1b1b
Comments: Downstream Z5017 > Z5016 > Z26015 > Z16988
Forward Primer: A11837_F GTCATTCGACTGCCTGCG
Reverse Primer: A11837_R GGTTGGAGAGGAATTGTTTAAAATTC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Z5017
Z5017
Z17107
Z17107
E1b-V13 Panel
E1b-V13 Panel
Z16988
Z16988
Z17264
Z17264
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies