Top » Catalog » SNPs » A11837

$18.00

A11837
[A11837]

A11837
hg38 Position: ChrY:11987755..11987755
Ancestral: C
Derived: A
Reference: Tyson Smith (2016)
ISOGG Haplogroup: E1b1b
Comments: Downstream Z5017 > Z5016 > Z26015 > Z16988
Forward Primer: A11837_F GTCATTCGACTGCCTGCG
Reverse Primer: A11837_R GGTTGGAGAGGAATTGTTTAAAATTC
Reviews

Customers who bought this product also purchased
BY50887
BY50887
BY155589
BY155589
Y110616
Y110616
S19928
S19928
BY153593
BY153593
F14488
F14488
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies