Top » Catalog » SNPs » Y90909

$18.00

Y90909
[Y90909]

Y90909
hg38 Position: ChrY:12157372..12157372
Ancestral: C
Derived: A
Reference: YFull (2017)
ISOGG Haplogroup: R1b
Comments: Below S5556
Forward Primer: Y90909_F AGGGGTCTGAGGTATCATGC
Reverse Primer: Y90909_R GGAACAAACAACTCCAGATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies