Top » Catalog » SNPs » A20440

$18.00

A20440
[A20440]

A20440
hg38 Position: ChrY:15277156..15277156
Ancestral: G
Derived: C
Reference: Connie McKenzie (2018)
ISOGG Haplogroup: R1b
Comments: Below U106 > FGC29405
Forward Primer: A20440_F TTGTTCACTGCCCAAGTGTC
Reverse Primer: A20440_R CCAAATTCTCTAGGCCATCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies