Top » Catalog » SNPs » A20442

$18.00

A20442
[A20442]

A20442
hg38 Position: ChrY:21423417..21423417
Ancestral: C
Derived: T
Reference: Connie McKenzie (2018)
ISOGG Haplogroup: R1b
Comments: Below U106 > FGC29405
Forward Primer: A20442_F GTGAAGTGCAGTGTGCCTTG
Reverse Primer: A20442_R TAAATGTCTTTTGTCTTTAATATCTCTCTACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies