Top » Catalog » SNPs » A20443

$18.00

A20443
[A20443]

A20443
hg38 Position: ChrY:7836942..7836942
Ancestral: G
Derived: A
Reference: Connie McKenzie (2018)
ISOGG Haplogroup: R1b
Comments: Below U106 > FGC29405
Forward Primer: A20443_F AGTTTACTGTTGGATCAGCCTCAC
Reverse Primer: A20443_R ATGCACAGTAGCAACAGCATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies