Top » Catalog » SNPs » A20444

$18.00

A20444
[A20444]

A20444
hg38 Position: ChrY:9567777..9567777
Ancestral: A
Derived: G
Reference: Connie McKenzie (2018)
ISOGG Haplogroup: R1b
Comments: Below U106 > FGC29405
Forward Primer: A20444_F AAAATGGTAAAGTAACCAGCAGTTTTC
Reverse Primer: A20444_R TAGATGACAGATGTATATGATGGGATATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies