Top » Catalog » SNPs » A20436

$18.00

A20436
[A20436]

A20436
hg38 Position: ChrY:20593498..20593498
Ancestral: C
Derived: N
Reference: Walter Little (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A20436_F TTTCAGCCTAGGTGCAGTGG
Reverse Primer: A20436_R GCCAAAAATATACTGAACATGGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies