Top » Catalog » SNPs » A20437

$18.00

A20437
[A20437]

A20437
hg38 Position: ChrY:21214919..21214919
Ancestral: C
Derived: N
Reference: Walter Little (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A20437_F ACACTGCGGGCTAAAAAGAG
Reverse Primer: A20437_R CTGGGCTGGAGTGCAATAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies