Top » Catalog » SNPs » L626

$18.00

L626
[L626]

L626
hg38 Position: ChrY:14380649..14380649
Ancestral: C
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b (Private)
Comments: Found in a hg R-L21 WTY participant
Forward Primer: L626_F TTCATGGGAACCTGAACTCC
Reverse Primer: L626_R TGGTCACACCAGTTCTCTGC
Reviews

Customers who bought this product also purchased
FGC3918
FGC3918
FGC3936
FGC3936
FGC3911
FGC3911
FGC3917
FGC3917
FGC3934
FGC3934
R1b-FGC3911 Comprehensive Test
R1b-FGC3911 Comprehensive Test
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies