Top » Catalog » SNPs » Y90935

$18.00

Y90935
[Y90935]

Y90935
hg38 Position: ChrY:12164938..12164938
Ancestral: A
Derived: G
Reference: YFull (2017)
ISOGG Haplogroup: I2a
Comments: Below CTS595 > A19384
Forward Primer: Y90935_F GATGTTGTGCTTTGTCTCATAAGAG
Reverse Primer: Y90935_R TCACCCATCAGTACTGGCAG
Reviews

Customers who bought this product also purchased
A15050
A15050
Y4252
Y4252
Y4200
Y4200
M26
M26
I2a-CTS595 Panel
I2a-CTS595 Panel
A19384
A19384
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies