Top » Catalog » SNPs » Y90935

$18.00

Y90935
[Y90935]

Y90935
hg38 Position: ChrY:12164938..12164938
Ancestral: A
Derived: G
Reference: YFull (2017)
ISOGG Haplogroup: I2a
Comments: Below CTS595 > A19384
Forward Primer: Y90935_F GATGTTGTGCTTTGTCTCATAAGAG
Reverse Primer: Y90935_R TCACCCATCAGTACTGGCAG
Reviews

Customers who bought this product also purchased
L233
L233
L160
L160
FGC56815
FGC56815
A19385
A19385
A10033
A10033
A8462
A8462
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies