Top » Catalog » SNPs » BY488

$18.00

BY488
[BY488]

BY488
hg38 Position: ChrY:19064454..19064454
Ancestral: C
Derived: T
Reference: FTDNA (2015)
ISOGG Haplogroup: R1b
Comments: Below U152 > A517 > A518 > A519 > A520
Forward Primer: BY488_F TGGCATTTGAAACAAAGCAG
Reverse Primer: BY488_R ATGCCCAGATCCTCTGTGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies