Top » Catalog » SNPs » Y22809

$18.00

Y22809
[Y22809]

Y22809
hg38 Position: ChrY:7755029..7755029
Ancestral: A
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: R1b
Comments: Below U152 > A517 > A518 > A519 > A520
Forward Primer: Y22809_F TCGCCAACATGGTAAATTCC
Reverse Primer: Y22809_R CTGCAAAGGCAGAGATTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies