Top » Catalog » SNPs » FGC13342

$18.00

FGC13342
[FGC13342]

FGC13342
hg38 Position: ChrY:13278247..13278247
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC13342_F CCAGTTCTGGCAAGATTCAAC
Reverse Primer: FGC13342_R ATCCAAGTGCCAACACCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies