Top » Catalog » SNPs » S4268

$18.00

S4268
[S4268]

S4268
hg38 Position: ChrY:14696139..14696139
Ancestral: C
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below P312 > DF19 > DF88 > S7449
Forward Primer: S4268_F TTTCTCTCTGTCAGCAGGAGC
Reverse Primer: S4268_R CCTCCAGAACTGGAGGGAATAC
Reviews

Customers who bought this product also purchased
DF88
DF88
BY19349
BY19349
Y13836
Y13836
S1393
S1393
BY162529
BY162529
DF19
DF19
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies