Top » Catalog » SNPs » S953

$18.00

S953
[S953]

S953
hg38 Position: ChrY:11933546..11933546
Ancestral: G
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b
Comments: Below DF21 > S971 > Z3004
Forward Primer: S953_F GAGACTGTGACAGATCATCAAGC
Reverse Primer: S953_R GGGTAAACTTATCTATCCATCCTCTATC
Reviews

Customers who bought this product also purchased
DF49
DF49
DF5
DF5
A14079
A14079
Z39589
Z39589
FGC3213
FGC3213
Z16274
Z16274
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x L829
$18.00
Haplogroup Info
Other products
Currencies